ca4a

Ensembl ID:
ENSDARG00000043589
ZFIN ID:
ZDB-GENE-080204-85
Description:
carbonic anhydrase IV a [Source:RefSeq peptide;Acc:NP_001107879]
Human Orthologue:
CA4
Human Description:
carbonic anhydrase IV [Source:HGNC Symbol;Acc:1375]
Mouse Orthologue:
Car4
Mouse Description:
carbonic anhydrase 4 Gene [Source:MGI Symbol;Acc:MGI:1096574]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa477 Nonsense Confirmed mutation in F2 line During 2014
sa12682 Nonsense Available for shipment Available now
sa20331 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3518 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa477
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064012 Nonsense 32 271 1 6
Genomic Location:
Chromosome 5 (position 2448299)
KASP Assay ID:
554-0209.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGACAGTCACCCATAAACATAGTGACCAAGCAAACCAAGCTGGACGAG[C/T]GATTGACACCTTTCAGATTCACTGGATACCAGACCGTGTTCGATGGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064012 Nonsense 57 271 2 6
Genomic Location:
Chromosome 5 (position 2445328)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGTTTTSTCTCTGTAATGACTGCGGTTTTRTCGTCTTTGCTTCAGTT[C/T]AGGTCAGTATTCCTGTCCCAGYCACTATTTCTGGAGGAAATCTGGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064012 Essential Splice Site 158 271 4 6
Genomic Location:
Chromosome 5 (position 2442271)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAATATGACCTGTTCGCACACGCACTGCGCAGCGTACAGAACACAAG[T/C]AAGACCAGATATTACACACTTTTATTACAGCATTTTTTTCCACAATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064012 Nonsense 204 271 5 6
Genomic Location:
Chromosome 5 (position 2440604)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGACCACACCRGGATGCWCCGAGGCTGTGGTGTGGACGGTGTTTGAA[A/T]AGCCCATTCCCCTGGACAGTGAACAGGTACTGAAACACTGATACCGCCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e67fq7m3