ifit2

Ensembl ID:
ENSDARG00000043584
ZFIN ID:
ZDB-GENE-030131-1055
Description:
Ifit2 protein [Source:UniProtKB/TrEMBL;Acc:Q5U3W8]
Human Orthologues:
IFIT1, IFIT1B, IFIT2, IFIT3, IFIT5
Human Descriptions:
interferon-induced protein with tetratricopeptide repeats 1 [Source:HGNC Symbol;Acc:5407]
interferon-induced protein with tetratricopeptide repeats 1B [Source:HGNC Symbol;Acc:23442]
interferon-induced protein with tetratricopeptide repeats 2 [Source:HGNC Symbol;Acc:5409]
interferon-induced protein with tetratricopeptide repeats 3 [Source:HGNC Symbol;Acc:5411]
interferon-induced protein with tetratricopeptide repeats 5 [Source:HGNC Symbol;Acc:13328]
Mouse Orthologues:
2010002M12Rik, Gm14446, I830012O16Rik, Ifit1, Ifit2, Ifit3
Mouse Descriptions:
interferon-induced protein with tetratricopeptide repeats 1 Gene [Source:MGI Symbol;Acc:MGI:99450]
interferon-induced protein with tetratricopeptide repeats 2 Gene [Source:MGI Symbol;Acc:MGI:99449]
interferon-induced protein with tetratricopeptide repeats 3 Gene [Source:MGI Symbol;Acc:MGI:1101055]
predicted gene 14446 Gene [Source:MGI Symbol;Acc:MGI:3650685]
RIKEN cDNA 2010002M12 gene Gene [Source:MGI Symbol;Acc:MGI:2148249]
RIKEN cDNA I830012O16 gene Gene [Source:MGI Symbol;Acc:MGI:3698419]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4711 Nonsense Mutation detected in F1 DNA During 2016
sa32151 Nonsense Mutation detected in F1 DNA During 2016
sa13361 Nonsense Available for shipment Available now
sa42926 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa4711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064003 Nonsense 211 449 2 2
Genomic Location:
Chromosome 17 (position 23438255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCATATCTATGAGCAAAGCATGTTTATGGTATAAATGCACTCCAGAG[C/T]AGAAAGCKGAGATTTTAGAGAAGGTGAAAACGGCAGCAGAGATCAACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064003 Nonsense 294 449 2 2
Genomic Location:
Chromosome 17 (position 23438004)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCTTTTGATGAATCTATTCGTGAAGGAGAGAGATTTCAAGAAAGGTA[C/A]CCCGAATCAATCAAAGTGTTGAAATGCCTGGCAGACACCTACAAATGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13361
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064003 Nonsense 313 449 2 2
Genomic Location:
Chromosome 17 (position 23437947)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAKCAAAGTGTTGAAATGCCTGGCAGACACCTACAAATGGAAGGTTTA[C/G]AAAATGAATGAAGACACAGAGGAAAGGRTGATTCTGGCTAGGAAAACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064003 Nonsense 394 449 2 2
Genomic Location:
Chromosome 17 (position 23437706)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTGACAAGTGGCAGTATATTTACTACTGTTATGCCAGTTATCTAAAT[C/T]AGTGTAAACGGTTCAGTGAGTCAGTACAGTTTCACATAAAAGGAGTGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link