gadd45aa

Ensembl ID:
ENSDARG00000043581
ZFIN ID:
ZDB-GENE-040426-1501
Description:
growth arrest and DNA-damage-inducible, alpha, a [Source:RefSeq peptide;Acc:NP_956870]
Human Orthologue:
GADD45A
Human Description:
growth arrest and DNA-damage-inducible, alpha [Source:HGNC Symbol;Acc:4095]
Mouse Orthologue:
Gadd45a
Mouse Description:
growth arrest and DNA-damage-inducible 45 alpha Gene [Source:MGI Symbol;Acc:MGI:107799]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1122 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1122
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063996 Nonsense 34 157 2 4
Genomic Location (Zv9):
Chromosome 2 (position 10072622)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10497718
KASP Assay ID:
554-1033.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTRATTAAGGCTCTGGAGGAGGTCCTGCGCTCCGCATTACCGCAGGGATG[T/A]ATTACAGTCGGGGTTTACGAGGCTGCAAAGTCCCTCAATGTGTAAGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link