gle1l

Ensembl ID:
ENSDARG00000043559
ZFIN ID:
ZDB-GENE-040831-4
Description:
Nucleoporin GLE1 [Source:UniProtKB/Swiss-Prot;Acc:Q6DRB1]
Human Orthologue:
GLE1
Human Description:
GLE1 RNA export mediator homolog (yeast) [Source:HGNC Symbol;Acc:4315]
Mouse Orthologues:
AC161416.1, Gle1
Mouse Description:
GLE1 RNA export mediator (yeast) Gene [Source:MGI Symbol;Acc:MGI:1921662]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34278 Nonsense Mutation detected in F1 DNA During 2017
e51 Nonsense Confirmed mutation in F2 line Unknown
sa34279 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6090 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34278
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101137 Nonsense 335 696 8 15
ENSDART00000128227 Nonsense 333 717 7 16
ENSDART00000129569 Nonsense 333 694 7 14

The following transcripts of ENSDARG00000043559 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 2735743)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2502132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTTGCAGGATCAGTTTCCCAGCGTGGAGGATTTGAGTGTGGCGGAG[C/T]GAGCTCTACAGGAAATGAGGTCATTGGTCCGAAGCCTGCAGGAAGCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
e51
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101137 Nonsense 400 696 9 15
ENSDART00000128227 Nonsense 398 717 8 16
ENSDART00000129569 Nonsense 398 694 8 14

The following transcripts of ENSDARG00000043559 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 2739639)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2506028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTTTACCTGACTTAAACAAGTGCTTTTTGCATTATTTACACAGGTCTG[C/T]AGACTGGAGCGGATGACAGCACTTTAAAGTGGTACAACAGCCTGCAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101137 Essential Splice Site 613 696 None 15
ENSDART00000128227 Essential Splice Site 611 717 None 16
ENSDART00000129569 Essential Splice Site 611 694 None 14

The following transcripts of ENSDARG00000043559 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 2744926)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2511315
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATGCTGCAATAATCCAGATGAGATGGCCATACTCCAGCAAACAAGGGG[T/A]GTGTGGTGCTTCTGTCCATTAATATCACAATAATCAATATATCGATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101137 Nonsense 657 696 15 15
ENSDART00000128227 Nonsense 655 717 14 16
ENSDART00000129569 Nonsense 655 694 14 14

The following transcripts of ENSDARG00000043559 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 2746496)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2512885
KASP Assay ID:
554-3848.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTTTGTCATGTGTGTCTCTTTAGGTCTGTGGAAATGCCCTAATGAAA[C/T]AATATCGCGTCCAGTTCTGGAAACTGATATTGATTATTAATGAAGAATAY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link