LOC795933

Ensembl ID:
ENSDARG00000043548
Human Orthologue:
ATG4D
Human Description:
ATG4 autophagy related 4 homolog D (S. cerevisiae) [Source:HGNC Symbol;Acc:20789]
Mouse Orthologue:
Atg4d
Mouse Description:
autophagy-related 4D (yeast) Gene [Source:MGI Symbol;Acc:MGI:2444308]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7916 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063936 Nonsense 467 485 10 10
Genomic Location:
Chromosome 1 (position 51912432)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGTCCGAGTGGAGGGTCYGTGGACGCTYCTGCACACATCTTCACCTG[C/A]AGCAGAWTGAGCCGCAACAACAAAAGAGGAAGCACAGATGAGTTTGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bnqlxl8w