si:ch211-246k22.2

Ensembl ID:
ENSDARG00000043527
ZFIN ID:
ZDB-GENE-040724-247
Description:
Presqualene diphosphate phosphatase [Source:UniProtKB/Swiss-Prot;Acc:Q5TZ07]
Human Orthologue:
PPAPDC2
Human Description:
phosphatidic acid phosphatase type 2 domain containing 2 [Source:HGNC Symbol;Acc:23682]
Mouse Orthologue:
Ppapdc2
Mouse Description:
phosphatidic acid phosphatase type 2 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1921661]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23658 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063882 Nonsense 141 190 1 3
ENSDART00000080333 Nonsense 141 288 1 2
Genomic Location (Zv9):
Chromosome 20 (position 15166941)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15261577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGGCCGCTCATGAAGCTCATCGAGGTGTCCGGTCACGGCATTCCGTG[G/A]CTGGCAGGAGCTGCTTACTGCCTGTACAAGAGCGACAGTCCCGCCGGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link