ccdc124

Ensembl ID:
ENSDARG00000043502
ZFIN ID:
ZDB-GENE-040426-1483
Description:
Coiled-coil domain-containing protein 124 [Source:UniProtKB/Swiss-Prot;Acc:Q6PHE8]
Human Orthologue:
CCDC124
Human Description:
coiled-coil domain containing 124 [Source:HGNC Symbol;Acc:25171]
Mouse Orthologue:
Ccdc124
Mouse Description:
coiled-coil domain containing 124 Gene [Source:MGI Symbol;Acc:MGI:1916403]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38674 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063863 Nonsense 31 216 2 5
Genomic Location (Zv9):
Chromosome 8 (position 13879613)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13324957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCAGGGCCCGAAAGGCCGAAGCCAAAGCAGTTGCTGATGCCCGCAAA[C/T]AGAAGGAGCTGGAGGATGCACTCTGGGAAGATAACGACAAACGTGTTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link