cltca

Ensembl ID:
ENSDARG00000043493
ZFIN ID:
ZDB-GENE-030131-2299
Description:
clathrin, heavy polypeptide a [Source:RefSeq peptide;Acc:NP_001005391]
Human Orthologue:
CLTC
Human Description:
clathrin, heavy chain (Hc) [Source:HGNC Symbol;Acc:2092]
Mouse Orthologue:
Cltc
Mouse Description:
clathrin, heavy polypeptide (Hc) Gene [Source:MGI Symbol;Acc:MGI:2388633]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21757 Nonsense Mutation detected in F1 DNA During 2014
sa21756 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16707 Nonsense Available for shipment Available now
sa14787 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063849 Nonsense 603 1680 12 31

The following transcripts of ENSDARG00000043493 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 29014756)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCAAGCACAGTGGTCTCTTACAGGTTGCAGATGCCATCCTAGGAAAC[C/T]AGATGTTCACCAACTACGATCGTGCCCACATCGCCCAACTGTGTGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063849 Essential Splice Site 649 1680 12 31

The following transcripts of ENSDARG00000043493 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 29014614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGACATCAAACGAGCTGTCGTGCACACACACCTGCTCAACCCGGAGG[T/C]ACACAACAAGTCTTTACATTCATGCCCAATTAAAGTGCAACCACCTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063849 Nonsense 943 1680 18 31

The following transcripts of ENSDARG00000043493 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 29004866)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGATTTTTCTCTACAGGTTTGCAATGAGAACTCGCTGTTCAAGAGTT[T/A]GTCCCGCTATCTKGTGCGCCGCAGGGACCCYGAGCTMTGGGCCAGTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063849 Nonsense 1043 1680 20 31

The following transcripts of ENSDARG00000043493 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 29002853)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCATCCTAACAGCCATCAAAGCTGACCGTACTCGGGTCATGGAGTA[C/A]ATCAACCGCCTGGACAACTAYGATGCCCCAGACATCGCCAACATCGCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ai3lomtb