tagap

Ensembl ID:
ENSDARG00000043475
ZFIN ID:
ZDB-GENE-040724-50
Description:
T-cell activation GTPase activating protein [Source:RefSeq peptide;Acc:NP_001004548]
Human Orthologue:
TAGAP
Human Description:
T-cell activation RhoGTPase activating protein [Source:HGNC Symbol;Acc:15669]
Mouse Orthologues:
CT485609.2, Tagap, Tagap1
Mouse Descriptions:
T-cell activation GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:1919786]
T-cell activation Rho GTPase-activating protein Gene [Source:MGI Symbol;Acc:MGI:3615484]
T-cell activation Rho GTPase-activating protein [Source:UniProtKB/Swiss-Prot;Acc:B2RWW0]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23651 Nonsense Mutation detected in F1 DNA During 2016
sa17749 Nonsense Available for shipment Available now
sa43398 Nonsense Mutation detected in F1 DNA During 2016
sa1810 Missense F2 line generated During 2016

Mutation Details

Allele Name:
sa23651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063826   None 687 1 10
ENSDART00000127654 Nonsense 164 876 5 14
Genomic Location (Zv9):
Chromosome 20 (position 13575276)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13764522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCATGCTTTTTTCTGCATTGCAGCTTGCCTGAGCTGAGGGATCACTG[G/A]TTACAGACTTTACACAGGTGAGCACTCGTTTACAACTCTAACGTTTACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063826   None 687 2 10
ENSDART00000127654 Nonsense 171 876 6 14
Genomic Location (Zv9):
Chromosome 20 (position 13574707)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13763953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTNACAGTAGTTGCAGAACTGAAATTTTGCAATTTGAAATGTGGWGACAGG[A/T]AAACTGTGGAGGCAAGGTTGTTAGCGGGCAGCACTTCCCCACCCCCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063826   None 687 2 10
ENSDART00000127654 Nonsense 178 876 6 14
Genomic Location (Zv9):
Chromosome 20 (position 13574685)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13763931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTGCAATTTGAAATGTGGTGACAGGAAAACTGTGGAGGCAAGGTTGT[T/A]AGCGGGCAGCACTTCCCCACCCCCCAGCGTCCTCATGAAGGTGCTGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1810
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063826 Missense 293 687 10 10
ENSDART00000127654 Missense 482 876 14 14
Genomic Location (Zv9):
Chromosome 20 (position 13565682)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13754928
KASP Assay ID:
554-1802.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAGACCTTTAACGCCTAAATTATTCTACACAGATTCAGCCTCCTTGAT[G/A]TCCCCTGATATATCTTTCGAAGTCCACCAACATGACTCTGCATACGACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link