atp2b3a

Ensembl ID:
ENSDARG00000043474
ZFIN ID:
ZDB-GENE-040718-174
Description:
plasma membrane calcium ATPase 3a [Source:RefSeq peptide;Acc:NP_001002472]
Human Orthologue:
ATP2B3
Human Description:
ATPase, Ca++ transporting, plasma membrane 3 [Source:HGNC Symbol;Acc:816]
Mouse Orthologue:
Atp2b3
Mouse Description:
ATPase, Ca++ transporting, plasma membrane 3 Gene [Source:MGI Symbol;Acc:MGI:1347353]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18912 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2421 Nonsense F2 line generated During 2014
sa10745 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045917 Essential Splice Site 320 723 7 13
ENSDART00000090252 Essential Splice Site 320 1245 7 22
ENSDART00000093117 Essential Splice Site 320 1176 7 20
ENSDART00000133922 None None 177 None 4
ENSDART00000135811 Essential Splice Site 320 1248 8 21

The following transcripts of ENSDARG00000043474 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 14544251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTAGCTCTAATTCTACTTGCCTTGATCAATTTGTCTCCACCCTCCACA[G/A]CTAAGAAACAGGATGAGGCTGTTGCCATGGAGATGCAGCCTCTGAAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2421
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045917 None None 723 None 13
ENSDART00000090252 Nonsense 883 1245 16 22
ENSDART00000093117 Nonsense 883 1176 16 20
ENSDART00000133922 None None 177 None 4
ENSDART00000135811 Nonsense 883 1248 17 21

The following transcripts of ENSDARG00000043474 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 14529650)
KASP Assay ID:
554-2680.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCAATTTTTTNATGCATTTGTGCATAGGATTCACCCCTGAAAKCTGTG[C/T]AGATGCTTTGGGTCAATCTGATCATGGACACATTTGCTTCTCTTGCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045917 None None 723 None 13
ENSDART00000090252 Nonsense 916 1245 16 22
ENSDART00000093117 Nonsense 916 1176 16 20
ENSDART00000133922 None None 177 None 4
ENSDART00000135811 Nonsense 916 1248 17 21

The following transcripts of ENSDARG00000043474 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 14529551)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTACGGAGCCRCCAACGGAAGCTCTGCTCCTGAGGAAGCCTTATGGC[C/T]GAAACAACCCTCTCATCTCCAGAACRATGATGAAGAACATCCTTGGACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m0lwml8c