rsph3

Ensembl ID:
ENSDARG00000043470
ZFIN ID:
ZDB-GENE-040724-173
Description:
radial spoke head 3 homolog [Source:RefSeq peptide;Acc:NP_001082864]
Human Orthologue:
RSPH3
Human Description:
radial spoke 3 homolog (Chlamydomonas) [Source:HGNC Symbol;Acc:21054]
Mouse Orthologues:
Rsph3a, Rsph3b
Mouse Descriptions:
radial spoke 3A homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:1914082]
radial spoke 3B homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:3630308]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23650 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063823 Essential Splice Site 233 334 5 10
ENSDART00000103394 Essential Splice Site 233 334 5 11
ENSDART00000128823 Essential Splice Site 233 284 5 6
Genomic Location (Zv9):
Chromosome 20 (position 13551825)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13741071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGTGCAGAGGCTTGAAGAGAGGGAACGGCGCCTCCGTGTGGAGAAGG[T/C]GAGAATGACAATCTATTTATTAATTTTTTTTTTTTTACTAATGATAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link