atp6v1b2

Ensembl ID:
ENSDARG00000043465
ZFIN IDs:
ZDB-GENE-030711-4, ZDB-GENE-030711-4
Description:
V-type proton ATPase subunit B, brain isoform [Source:RefSeq peptide;Acc:NP_878299]
Human Orthologue:
ATP6V1B2
Human Description:
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 [Source:HGNC Symbol;Acc:854]
Mouse Orthologue:
Atp6v1b2
Mouse Description:
ATPase, H+ transporting, lysosomal V1 subunit B2 Gene [Source:MGI Symbol;Acc:MGI:109618]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15671 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063806 Nonsense 41 509 1 14
ENSDART00000063810 Nonsense 35 196 1 7
Genomic Location:
Chromosome 10 (position 19585023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTCGCCGTTCGGGAAAATGTCCTTGCCGTGACTCGTGACTACATTTCT[C/T]AGCCGAGATTAAGTGAGTGTACAGTGCTGACTATRAAGGGCCCTTACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder (broad): Novel loci for major depression identified by genome-wide association study of Sequenced Treatment Alternatives to Relieve Depression and meta-analysis of three studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h5ew7d2v