gapdh

Ensembl ID:
ENSDARG00000043457
ZFIN ID:
ZDB-GENE-030115-1
Description:
Glyceraldehyde-3-phosphate dehydrogenase [Source:UniProtKB/Swiss-Prot;Acc:Q5XJ10]
Human Orthologue:
GAPDH
Human Description:
glyceraldehyde-3-phosphate dehydrogenase [Source:HGNC Symbol;Acc:4141]
Mouse Orthologues:
AC127324.1, AC142104.1, AC147142.1, AC157595.1, Gapdh, Gm10290, Gm10291, Gm10293, Gm10313, Gm10327, Gm10358, Gm10359, Gm10481, Gm10566, Gm12033, Gm2574, Gm2606, Gm3200, Gm3222, Gm3272, Gm3839, Gm4609, Gm4795, Gm5069, Gm5138, Gm5507, Gm5559, Gm6316, Gm6498, Gm6981, Gm7251, Gm7293, Gm7627, Gm7713, Gm8055, Gm9034
Mouse Descriptions:
glyceraldehyde-3-phosphate dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:95640]
Glyceraldehyde-3-phosphate dehydrogenase [Source:UniProtKB/Swiss-Prot;Acc:P16858]
predicted gene 10358 Pseudogene [Source:MGI Symbol;Acc:MGI:3708786]
predicted gene 10359 Pseudogene [Source:MGI Symbol;Acc:MGI:3708724]
predicted gene 10481 Pseudogene [Source:MGI Symbol;Acc:MGI:3708707]
predicted gene 10566 Pseudogene [Source:MGI Symbol;Acc:MGI:3642220]
predicted gene 12033 Gene [Source:MGI Symbol;Acc:MGI:3650772]
predicted gene 4609 Pseudogene [Source:MGI Symbol;Acc:MGI:3782792]
predicted gene 5138 Pseudogene [Source:MGI Symbol;Acc:MGI:3779464]
predicted gene 5507 Pseudogene [Source:MGI Symbol;Acc:MGI:3648656]
predicted gene 5559 Pseudogene [Source:MGI Symbol;Acc:MGI:3779498]
predicted gene 6498 Pseudogene [Source:MGI Symbol;Acc:MGI:3647773]
predicted gene 7293 Pseudogene [Source:MGI Symbol;Acc:MGI:3779717]
predicted gene 7627 Pseudogene [Source:MGI Symbol;Acc:MGI:3643954]
predicted gene 7713 Pseudogene [Source:MGI Symbol;Acc:MGI:3644622]
predicted pseudogene 10290 Pseudogene [Source:MGI Symbol;Acc:MGI:3642597]
predicted pseudogene 10291 Pseudogene [Source:MGI Symbol;Acc:MGI:3641638]
predicted pseudogene 10293 Pseudogene [Source:MGI Symbol;Acc:MGI:3704216]
predicted pseudogene 10313 Pseudogene [Source:MGI Symbol;Acc:MGI:3642852]
predicted pseudogene 10327 Pseudogene [Source:MGI Symbol;Acc:MGI:3704356]
predicted pseudogene 2574 Pseudogene [Source:MGI Symbol;Acc:MGI:3780741]
predicted pseudogene 2606 Pseudogene [Source:MGI Symbol;Acc:MGI:3780774]
predicted pseudogene 3200 Pseudogene [Source:MGI Symbol;Acc:MGI:3781379]
predicted pseudogene 3222 Pseudogene [Source:MGI Symbol;Acc:MGI:3781401]
predicted pseudogene 3272 Pseudogene [Source:MGI Symbol;Acc:MGI:3781450]
predicted pseudogene 3839 Pseudogene [Source:MGI Symbol;Acc:MGI:3782011]
predicted pseudogene 4795 Pseudogene [Source:MGI Symbol;Acc:MGI:3646519]
predicted pseudogene 5069 Pseudogene [Source:MGI Symbol;Acc:MGI:3644516]
predicted pseudogene 6316 Pseudogene [Source:MGI Symbol;Acc:MGI:3646088]
predicted pseudogene 6981 Pseudogene [Source:MGI Symbol;Acc:MGI:3646966]
predicted pseudogene 7251 Pseudogene [Source:MGI Symbol;Acc:MGI:3646144]
predicted pseudogene 8055 Pseudogene [Source:MGI Symbol;Acc:MGI:3643695]
predicted pseudogene 9034 Pseudogene [Source:MGI Symbol;Acc:MGI:3643526]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6419 Nonsense Mutation detected in F1 DNA During 2017
sa42694 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063800 Nonsense 92 333 5 12
ENSDART00000135146   None 53 None 4
ENSDART00000139939 Nonsense 92 240 5 9
ENSDART00000147739 Nonsense 92 224 5 8
Genomic Location (Zv9):
Chromosome 16 (position 19256654)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17286977
KASP Assay ID:
554-5098.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGGAGGGACCCAGCCAAYATTAAGTGGGGTGATGCAGGTGCTACTTA[T/A]GTTGTGGAGTCTACTGGTGTCTTCACTACTATTGAGAAGGCTTCTGTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063800 Nonsense 170 333 7 12
ENSDART00000135146   None 53 None 4
ENSDART00000139939 Nonsense 170 240 7 9
ENSDART00000147739 Nonsense 170 224 7 8
Genomic Location (Zv9):
Chromosome 16 (position 19256033)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17286356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCCTGGCTCCTTTGGCAAAGGTCATTAATGATAACTTTGTCATCGTT[G/T]AAGGTCTTATGGTAAGATTAAATGGCCTTTCCAATCTCCTCTAAAAGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link