itm2ca

Ensembl ID:
ENSDARG00000043448
ZFIN ID:
ZDB-GENE-040718-284
Description:
integral membrane protein 2Ca [Source:RefSeq peptide;Acc:NP_001002549]
Human Orthologue:
ITM2C
Human Description:
integral membrane protein 2C [Source:HGNC Symbol;Acc:6175]
Mouse Orthologue:
Itm2c
Mouse Description:
integral membrane protein 2C Gene [Source:MGI Symbol;Acc:MGI:1927594]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22713 Essential Splice Site Available for shipment Available now
sa32058 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063783 Essential Splice Site 81 260 3 6
Genomic Location (Zv9):
Chromosome 15 (position 38654181)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40169968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGCATTAGCTCTATAATTATTAGCTGTCTTTAATGTGATGATGATTC[A/C]GGTTCCGGATCAAAGTCGGTTCCACTGCCGCGTCGTGTATGAGGACTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063783 Nonsense 206 260 5 6
Genomic Location (Zv9):
Chromosome 15 (position 38655629)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40171416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTGTGCAGGAAGAGATGGTCGTGACTGGTCGTGTTAATAATATGCAT[C/T]AGCTTGGCCGGTTTATTTACCGTCTGTGTAATGGTAAAGATACGTACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link