kcnj13

Ensembl ID:
ENSDARG00000043443
ZFIN ID:
ZDB-GENE-070129-1
Description:
inward rectifier potassium channel 13 [Source:RefSeq peptide;Acc:NP_001039014]
Human Orthologue:
KCNJ13
Human Description:
potassium inwardly-rectifying channel, subfamily J, member 13 [Source:HGNC Symbol;Acc:6259]
Mouse Orthologue:
Kcnj13
Mouse Description:
potassium inwardly-rectifying channel, subfamily J, member 13 Gene [Source:MGI Symbol;Acc:MGI:378103

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13246 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063777 Nonsense 224 362 2 2
Genomic Location:
Chromosome 15 (position 38858258)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCACAGCCGCTAGTGGACGTATCCGTGAGTKCTGTCCTCTACGAGGAG[C/T]GAGACGATCACGAACTCCACCAAACTGCTCTGGAGTTCAGCATCGACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fzthbqtv