b3gntl1

Ensembl ID:
ENSDARG00000043431
ZFIN ID:
ZDB-GENE-050913-133
Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like protein 1 [Source:RefSeq peptide;A
Human Orthologue:
B3GNTL1
Human Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1 [Source:HGNC Symbol;Acc:21727]
Mouse Orthologue:
B3gntl1
Mouse Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1 Gene [Source:MGI Symbol;Acc:MGI:2

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17799 Nonsense Available for shipment Available now
sa1977 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17799
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063750 Nonsense 147 338 7 12
ENSDART00000104222 Nonsense 188 379 7 12
ENSDART00000143018 None None 143 None 5
Genomic Location:
Chromosome 1 (position 57657437)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGATCGTTTCTGNNNNNNNNTGTGTGTGTGTNNNNTGTGCAGGTCTA[C/A]ACGTCTCATGGGCCGACCGTCATCATGCCGTCCTGGTTCTGCTCGCGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1977
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063750 Essential Splice Site 312 338 11 12
ENSDART00000104222 Essential Splice Site 353 379 11 12
ENSDART00000143018 None None 143 None 5
Genomic Location:
Chromosome 1 (position 57653994)
KASP Assay ID:
554-2720.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTCACTTCAGAAACGCCTCGCCACCATTTATTGTGTGTGTCAAACTG[G/A]TGAGTGTGTGTTTGTGTGTGTGNNNNTGTATGTGTTAGTGTGTCTGTATGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y22wdkm1