xkr6

Ensembl ID:
ENSDARG00000043410
ZFIN ID:
ZDB-GENE-040724-153
Description:
XK, Kell blood group complex subunit-related family, member 6 [Source:RefSeq peptide;Acc:NP_0010122
Human Orthologue:
XKR6
Human Description:
XK, Kell blood group complex subunit-related family, member 6 [Source:HGNC Symbol;Acc:27806]
Mouse Orthologue:
Xkr6
Mouse Description:
X Kell blood group precursor related family member 6 homolog Gene [Source:MGI Symbol;Acc:MGI:2447765

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37001 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063725 Essential Splice Site 255 578 None 3
ENSDART00000131367 Essential Splice Site 62 385 None 2
Genomic Location (Zv9):
Chromosome 20 (position 18875435)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18903692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTAATTTCCCTTTTTTGTGATATCAGTATGTCTCTGTGTTGTCT[A/T]GGTGTGTCGGCAGTCACGTCTCTCCTCTCTCTTTCCTGGGTTCTGGCCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link