xkr6

Ensembl ID:
ENSDARG00000043410
ZFIN ID:
ZDB-GENE-040724-153
Description:
XK, Kell blood group complex subunit-related family, member 6 [Source:RefSeq peptide;Acc:NP_0010122
Human Orthologue:
XKR6
Human Description:
XK, Kell blood group complex subunit-related family, member 6 [Source:HGNC Symbol;Acc:27806]
Mouse Orthologue:
Xkr6
Mouse Description:
X Kell blood group precursor related family member 6 homolog Gene [Source:MGI Symbol;Acc:MGI:2447765

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4138 Nonsense Mutation detected in F1 DNA During 2016
sa19231 Nonsense Mutation detected in F1 DNA During 2016
sa37001 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa4138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063725 Nonsense 137 578 1 3
ENSDART00000131367   None 385 None 2
ENSDART00000063725 Nonsense 137 578 1 3
ENSDART00000131367   None 385 None 2
Genomic Location:
Chromosome 20 (position 18987075)
KASP Assay ID:
2261-4121.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGGTGCCGTCGGTCCTGGTCCAGATCCTGAGCTTCAGGTGGTTCGTG[C/T]AGGATTACACGGGGGGCGGCTTGGGCTCCGTGGAGGGTCTCAGCAGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063725 Nonsense 137 578 1 3
ENSDART00000131367   None 385 None 2
ENSDART00000063725 Nonsense 137 578 1 3
ENSDART00000131367   None 385 None 2
Genomic Location:
Chromosome 20 (position 18987075)
KASP Assay ID:
2261-4121.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGTGCCGTCGGTCCTGGTCCAGATCCTGAGCTTCAGGTGGTTCGTG[C/T]AGGATTACACGGGGGGCGGCTTGGGCTCCGTGGAGGGTCTCAGCAGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063725 Essential Splice Site 255 578 None 3
ENSDART00000131367 Essential Splice Site 62 385 None 2
Genomic Location:
Chromosome 20 (position 18875435)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTAATTTCCCTTTTTTGTGATATCAGTATGTCTCTGTGTTGTCT[A/T]GGTGTGTCGGCAGTCACGTCTCTCCTCTCTCTTTCCTGGGTTCTGGCCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link