rpp21

Ensembl ID:
ENSDARG00000043404
ZFIN ID:
ZDB-GENE-040801-37
Description:
ribonuclease P protein subunit p21 [Source:RefSeq peptide;Acc:NP_001003530]
Human Orthologue:
RPP21
Human Description:
ribonuclease P/MRP 21kDa subunit [Source:HGNC Symbol;Acc:21300]
Mouse Orthologue:
Rpp21
Mouse Description:
ribonuclease P 21 subunit (human) Gene [Source:MGI Symbol;Acc:MGI:1914926]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6701 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063719 Nonsense 146 165 5 5
Genomic Location (Zv9):
Chromosome 22 (position 15575563)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15403572
KASP Assay ID:
554-4844.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATCTAACTCAACAACCCAAGGGAAGAAATGTGATGGTTCAAGTGGTT[C/A]AGCATCCACAGCAGCGAAGACTACACCTACAGCTCAAACAAATAAACCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link