si:ch211-101l18.3

Ensembl ID:
ENSDARG00000043388
ZFIN ID:
ZDB-GENE-040724-177
Description:
Apoptosis-related protein 3 [Source:UniProtKB/Swiss-Prot;Acc:A3KNS9]
Human Orthologue:
C2orf28
Human Description:
chromosome 2 open reading frame 28 [Source:HGNC Symbol;Acc:24090]
Mouse Orthologue:
0610007C21Rik
Mouse Description:
RIKEN cDNA 0610007C21 gene Gene [Source:MGI Symbol;Acc:MGI:1918918]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9283 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063696 Essential Splice Site 75 230 2 7
Genomic Location (Zv9):
Chromosome 20 (position 19585309)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19613566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCACTGCTGTTTTAAAAACAACACCAGCGATGTCGACACTATTATAGG[G/A]TAGGTTCATTTACTAGTATTCGTTTTYATAACTGAAATATTTAATAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link