prkcz

Ensembl ID:
ENSDARG00000043332
ZFIN ID:
ZDB-GENE-070511-1
Description:
protein kinase C zeta type [Source:RefSeq peptide;Acc:NP_001025262]
Human Orthologue:
PRKCZ
Human Description:
protein kinase C, zeta [Source:HGNC Symbol;Acc:9412]
Mouse Orthologue:
Prkcz
Mouse Description:
protein kinase C, zeta Gene [Source:MGI Symbol;Acc:MGI:97602]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16811 Nonsense Available for shipment Available now
sa14706 Nonsense Available for shipment Available now
sa41168 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12571 Nonsense Available for shipment Available now
sa21245 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063592 Nonsense 33 599 2 18
ENSDART00000063592 Nonsense 33 599 2 18
Genomic Location (Zv9):
Chromosome 8 (position 18260305)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17705193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTATMYGGTTNGTTTTGTGTGCAGGGACATGCTGATCTCAGAYCTGGATT[T/A]GGCGCTGACGTACACWGAGGTGTGTAAGGAGGTCAGAGAGATGTGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14706
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063592 Nonsense 33 599 2 18
ENSDART00000063592 Nonsense 33 599 2 18
Genomic Location (Zv9):
Chromosome 8 (position 18260305)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17705193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTATMCGGTTNGTTTTGTGTGCAGGGACATGCTGATCTCAGAYCTGGATT[T/A]GGCGCTGACGTACACWGAGGTGTGTAAGGAGGTCAGAGAGATGTGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41168
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063592 Essential Splice Site 95 599 3 18
Genomic Location (Zv9):
Chromosome 8 (position 18258283)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17703171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTTTCGGATCTACAGCCGAAACCGGCACTCTGGACTCCTCCTGCATGG[T/C]ACTCATTCACACAAACCGATGCAAATTAATCAGTTCATTCCTGCCTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063592 Nonsense 456 599 14 18
Genomic Location (Zv9):
Chromosome 8 (position 18109536)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17554424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACTGGTGGGCTCTCGGCGTGCTCATGTTTGAGATGATGGCGGGCCGAT[C/A]GCCCTTCGATATCATCACTGACAATCCTGACATGAACACAGAGGAGTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063592 Nonsense 472 599 14 18
Genomic Location (Zv9):
Chromosome 8 (position 18109487)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17554375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCCCTTCGATATCATCACTGACAATCCTGACATGAACACAGAGGAGTA[T/A]CTCTTCCAGGGTGAGTCCACCTTAATCCAGCTTAATTCTAAACCATATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Working memory: Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link