si:dkey-161n17.1

Ensembl ID:
ENSDARG00000043328
ZFIN ID:
ZDB-GENE-041014-8
Description:
Novel protein similar to vertebrate FIP1 like 1 (S. cerevisiae) (FIP1L1) [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
FIP1L1
Human Description:
FIP1 like 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:19124]
Mouse Orthologue:
Fip1l1
Mouse Description:
FIP1 like 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914149]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16054 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063609 Nonsense 409 465 14 15
ENSDART00000148084   None 368 None 13
Genomic Location (Zv9):
Chromosome 20 (position 22731342)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22845373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAAGAGAAGGAMCAAGAGATAGACAWCGAGAAAGAAGACACCGAGAA[C/T]AAAATGAACACCGATCCTCACGCAGGTAATGCAGAGTCAGAAATGTACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link