lnx1

Ensembl ID:
ENSDARG00000043323
ZFIN ID:
ZDB-GENE-030131-9439
Description:
E3 ubiquitin-protein ligase LNX [Source:RefSeq peptide;Acc:NP_001068581]
Human Orthologue:
LNX1
Human Description:
ligand of numb-protein X 1 [Source:HGNC Symbol;Acc:6657]
Mouse Orthologue:
Lnx1
Mouse Description:
ligand of numb-protein X 1 Gene [Source:MGI Symbol;Acc:MGI:1278335]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1136 Nonsense F2 line generated During 2014
sa23685 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1136
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063604 None None 164 None 10
ENSDART00000063606 Nonsense 24 754 2 11
ENSDART00000143286 None None 164 None 3
ENSDART00000147520 Nonsense 35 276 2 4
Genomic Location:
Chromosome 20 (position 22659954)
KASP Assay ID:
554-1047.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGTCACTCCCACCGCCCCTCCTCCTGATCTCTGCCACATCTGTGGA[C/T]AACGCCACCTACAGGAGGAGAACCACGAATATACCTACAAAGAGGASGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063604 None None 164 None 10
ENSDART00000063606 Nonsense 65 754 2 11
ENSDART00000143286 None None 164 None 3
ENSDART00000147520 Nonsense 76 276 2 4
Genomic Location:
Chromosome 20 (position 22660079)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTCCAGCCCCTGATCCGGCCGCTGGACACCCCATGTGGGCACACCTA[C/A]TGCCAGGAGTGTTTGACAAACTTTCTGCTGGAGAGCGACTTCTGCCCGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sl9oyi8l