kita

Ensembl ID:
ENSDARG00000043317
ZFIN IDs:
ZDB-GENE-980526-464, ZDB-GENE-980526-464
Description:
Mast/stem cell growth factor receptor [Source:UniProtKB/Swiss-Prot;Acc:Q8JFR5]
Human Orthologue:
KIT
Human Description:
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog [Source:HGNC Symbol;Acc:6342]
Mouse Orthologue:
Kit
Mouse Description:
kit oncogene Gene [Source:MGI Symbol;Acc:MGI:96677]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6630 Nonsense Confirmed mutation in F2 line During 2014
sa18325 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6630
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011135 Nonsense 187 972 3 21
ENSDART00000108974 Nonsense 178 803 2 18
ENSDART00000110967 Nonsense 194 979 2 20
Genomic Location:
Chromosome 20 (position 22441161)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGGATGTTACGTCTGCGTCGGAACTTTGGATGCCGCTACGGTTAAAT[C/A]AGGAAGATATCAACTTACTGTTCGGCTTGGTGAGAGACAAAAATGRAGAW
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
melanocyte
ZFA:0009091
present in fewer numbers in organism
PATO:0001997
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
melanocyte
ZFA:0009091
quality
PATO:0000001
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa18325
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011135 Nonsense 661 972 14 21
ENSDART00000108974 Nonsense 652 803 13 18
ENSDART00000110967 Nonsense 668 979 13 20
Genomic Location:
Chromosome 20 (position 22418980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTGGTYTGTTGTGCAGGTCCAACTCTAGTTATAACAGAGTACTGCTG[T/A]TTCGGCGACCTGTTGAACTTCCTGCGCAGAAGGAGAGTATATTTCTACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hs8iqs2u