obscn

Ensembl ID:
ENSDARG00000043309
ZFIN ID:
ZDB-GENE-040812-4
Description:
Obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF [Source:UniProtKB/TrEMBL;Acc:B8JI51]
Human Orthologues:
MYOT, MYPN, PALLD
Human Descriptions:
myopalladin [Source:HGNC Symbol;Acc:23246]
myotilin [Source:HGNC Symbol;Acc:12399]
palladin, cytoskeletal associated protein [Source:HGNC Symbol;Acc:17068]
Mouse Orthologues:
Myot, Mypn, Palld
Mouse Descriptions:
myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]
myotilin Gene [Source:MGI Symbol;Acc:MGI:1889800]
palladin, cytoskeletal associated protein Gene [Source:MGI Symbol;Acc:MGI:1919583]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21250 Nonsense Available for shipment Available now
sa12899 Nonsense Available for shipment Available now
sa1115 Nonsense Available for shipment Available now
sa17011 Nonsense Available for shipment Available now
sa12781 Nonsense Available for shipment Available now
sa8312 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1045 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa21250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Nonsense 223 1992 5 34
Genomic Location:
Chromosome 8 (position 18915602)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCCATGTCTTTCTCTTCAAAGACTGCATAGTCTTCTGCAAGCCAAAA[A/T]GAGAAGTTGGCACACACACCGAGGCCTACATATTCAAGAATAAAATGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Nonsense 259 1992 6 34
Genomic Location:
Chromosome 8 (position 18914862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGATGTAAAGGACACAGCAGAAGGAGATGACAGRTCATTTGGGCTTTG[G/A]CACGAGCAWCGGGGAATGGTGAGAAAAATCATTTTGYAAGCTCGTTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Nonsense 272 1992 6 34
Genomic Location:
Chromosome 8 (position 18914825)
KASP Assay ID:
554-1017.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTGGGCTTTGGCACGAGCATCGGGGAATGGTGAGAAAAATCATTTTG[C/T]AAGCTCGTTCCATCCTCCTTCGTCTSTCCTGGCTCAAAGACCTGAGAGAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa17011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Nonsense 410 1992 9 34
Genomic Location:
Chromosome 8 (position 18912107)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCTCCRAGTTTCAMAACCAGACTGCAGAACGCAGTGCTTGTAAAAGGA[C/T]AAGATGTGCAGTTCAWGTGTTCCACACAATCTGTTCCTTTCCCATCAAYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Nonsense 1602 1992 27 34
Genomic Location:
Chromosome 8 (position 18894918)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTYTGGAAACCTGTGCCATCCAAAGAGCTTGTCACATATTGTATTCAGTA[T/A]AGTGTAAATGGTAAGAATAYATACTAAAGSAATACACTCAGTYCCAWCTR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Essential Splice Site 1662 1992 28 34
Genomic Location:
Chromosome 8 (position 18894626)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTTCAGTGATCCATCACCACCTGCCTTCATGGCAATACCTTATGAAGG[T/C]ATGCTAATTAAAATAAAAATAAMACTGAAGTTAAATAGTTTATTTACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1045
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063577 Nonsense 1750 1992 30 34
Genomic Location:
Chromosome 8 (position 18892538)
KASP Assay ID:
554-0948.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATCAAGTGCTCCGTCGACTCRGCCACCCTCGAATCGTCCAGCTGCATT[C/A]GGCCATCCTCACCTCCACCTGCCTGCTGCTTATAGAGGAGCTGTGCTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tx5k3wot