irf6

Ensembl ID:
ENSDARG00000043296
ZFIN ID:
ZDB-GENE-040426-1137
Description:
interferon regulatory factor 6 [Source:RefSeq peptide;Acc:NP_956892]
Human Orthologue:
IRF6
Human Description:
interferon regulatory factor 6 [Source:HGNC Symbol;Acc:6121]
Mouse Orthologue:
Irf6
Mouse Description:
interferon regulatory factor 6 Gene [Source:MGI Symbol;Acc:MGI:1859211]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19276 Nonsense Mutation detected in F1 DNA During 2014
sa11387 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061535 Nonsense 259 492 6 8
ENSDART00000063562 Nonsense 259 492 6 9
ENSDART00000139501 Nonsense 43 161 3 3
Genomic Location:
Chromosome 22 (position 2347534)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGTCTGCAGTGACGGATCTGGAGGTGCAGTTCTACTACCGCGGTAAA[G/T]AGGTGTGTCCCCCATTGACGGTCAGTAACCCGCAGGGCTGTCGTCTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061535 Nonsense 342 492 6 8
ENSDART00000063562 Nonsense 342 492 6 9
ENSDART00000139501 Nonsense 126 161 3 3
Genomic Location:
Chromosome 22 (position 2347785)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTGGAGGTCAGCGGGCACGACATCTACGCCGTGCGCCTCTGCCAGTG[T/A]AAGGTGTACTGGTCCGGTCCCTGCGCCCCCAACCCAAACGCTCCCAACCY
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cleft lip: A genome-wide association study of cleft lip with and without cleft palate identifies risk variants near MAFB and ABCA4. (View Study)
  • Orofacial clefts: Genome-wide meta-analyses of nonsyndromic cleft lip with or without cleft palate identify six new risk loci. (View Study)
  • Orofacial clefts: Key susceptibility locus for nonsyndromic cleft lip with or without cleft palate on chromosome 8q24. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lj35nlah