si:ch211-103a14.5

Ensembl ID:
ENSDARG00000043294
ZFIN ID:
ZDB-GENE-091204-414
Human Orthologue:
GUCA1A
Human Description:
guanylate cyclase activator 1A (retina) [Source:HGNC Symbol;Acc:4678]
Mouse Orthologue:
Guca1a
Mouse Description:
guanylate cyclase activator 1a (retina) Gene [Source:MGI Symbol;Acc:MGI:102770]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3155 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa3155
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063554 Nonsense 164 201 4 5
ENSDART00000146591 Nonsense 170 199 4 4
Genomic Location (Zv9):
Chromosome 22 (position 2317076)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1129924
KASP Assay ID:
554-2548.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTGTTGACTATGGATGAGTTTATGGAGGGCATTCAGGCAGACGAGTA[T/A]CTCTCCACCATGCTGACTCAGAGTCTGGATCTCACACACATCGTCAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link