ccbl2

Ensembl ID:
ENSDARG00000043280
ZFIN ID:
ZDB-GENE-040426-1299
Description:
Kynurenine--oxoglutarate transaminase 3 [Source:UniProtKB/Swiss-Prot;Acc:Q7T3E5]
Human Orthologue:
CCBL2
Human Description:
cysteine conjugate-beta lyase 2 [Source:HGNC Symbol;Acc:33238]
Mouse Orthologue:
Ccbl2
Mouse Description:
cysteine conjugate-beta lyase 2 Gene [Source:MGI Symbol;Acc:MGI:2677849]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32552 Essential Splice Site Available for shipment Available now
sa30336 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063536 Essential Splice Site 51 450 2 13
Genomic Location (Zv9):
Chromosome Zv9_scaffold3471 (position 42839)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25272121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAACACAAAAACGCGAGGAGGATAGAAGGCCTGGACAAGAATGTATG[G/A]TAAGAATTGAGAGGATATTTGCTAACACTTTCTCACAAACTTGTTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063536 Nonsense 180 450 6 13
Genomic Location (Zv9):
Chromosome Zv9_scaffold3471 (position 44968)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25274250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTATATTTACATGAATCATAACACTTGATTTCCCTGTTTTGCAGAAGT[C/A]GACAGCAACAACTGGTATAAGTAGTGCTGACTGGGTTCTGGACCAGGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link