morc3b

Ensembl ID:
ENSDARG00000043271
ZFIN ID:
ZDB-GENE-040801-98
Description:
MORC family CW-type zinc finger 3b [Source:RefSeq peptide;Acc:NP_001003579]
Human Orthologue:
MORC3
Human Description:
MORC family CW-type zinc finger 3 [Source:HGNC Symbol;Acc:23572]
Mouse Orthologue:
Morc3
Mouse Description:
microrchidia 3 Gene [Source:MGI Symbol;Acc:MGI:2136841]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25653 Nonsense Mutation detected in F1 DNA During 2015
sa19564 Nonsense Mutation detected in F1 DNA During 2015
sa3370 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa25653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074450 Nonsense 243 763 6 17
ENSDART00000137448   None 173 None 4
Genomic Location:
Chromosome 1 (position 47684971)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAGAAGCAACGGTGACCTCGCCATGATCCCAGAAAGTGAATACTCAT[T/A]ACGGGTGAGCGGAAATATCTTCTAGATAGAGTTGATGGTAGAAACTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074450 Nonsense 282 763 7 17
ENSDART00000137448   None 173 None 4
Genomic Location:
Chromosome 1 (position 47687174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGTCAACTGATATCCAAAAGTCTGGCTCATATTGCGCAGGACAACTA[C/A]AGGCCGTCATTCCTTGTATCCTTTCAAAACATATTATGCTTGTTTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074450 Nonsense 571 763 16 17
ENSDART00000137448   None 173 None 4
Genomic Location:
Chromosome 1 (position 47696148)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCCTCTCAAACTCTCCATCCTGCTTTGAACAAGGAGAGAAAATCCT[T/A]GTCCTTGATGAAAGGAYTGGAGTTGCATCGGGGTCCCGTATGTGAAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j2mkb5sb