morc3b

Ensembl ID:
ENSDARG00000043271
ZFIN ID:
ZDB-GENE-040801-98
Description:
MORC family CW-type zinc finger 3b [Source:RefSeq peptide;Acc:NP_001003579]
Human Orthologue:
MORC3
Human Description:
MORC family CW-type zinc finger 3 [Source:HGNC Symbol;Acc:23572]
Mouse Orthologue:
Morc3
Mouse Description:
microrchidia 3 Gene [Source:MGI Symbol;Acc:MGI:2136841]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19564 Nonsense Mutation detected in F1 DNA During 2014
sa3370 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074450 Nonsense 282 763 7 17
ENSDART00000137448 None None 173 None 4
Genomic Location:
Chromosome 1 (position 47687174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGTCAACTGATATCCAAAAGTCTGGCTCATATTGCGCAGGACAACTA[C/A]AGGCCGTCATTCCTTGTATCCTTTCAAAACATATTATGCTTGTTTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074450 Nonsense 571 763 16 17
ENSDART00000137448 None None 173 None 4
Genomic Location:
Chromosome 1 (position 47696148)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCCTCTCAAACTCTCCATCCTGCTTTGAACAAGGAGAGAAAATCCT[T/A]GTCCTTGATGAAAGGAYTGGAGTTGCATCGGGGTCCCGTATGTGAAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j2mkb5sb