ckbb

Ensembl ID:
ENSDARG00000043257
ZFIN ID:
ZDB-GENE-020103-2
Description:
brain creatine kinase b [Source:RefSeq peptide;Acc:NP_775329]
Human Orthologue:
CKB
Human Description:
creatine kinase, brain [Source:HGNC Symbol;Acc:1991]
Mouse Orthologue:
Ckb
Mouse Description:
creatine kinase, brain Gene [Source:MGI Symbol;Acc:MGI:88407]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17357 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17357
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027603 Nonsense 170 381 5 8
ENSDART00000063498 None None 171 None 7
ENSDART00000145601 None None 171 None 5

The following transcripts of ENSDARG00000043257 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 20890209)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACTTATCCTTTGRCTTCACAGCTTTGGGGGCTCTTGATGGTGATCTC[A/T]AAGGAAAGTACTACGCCCTCAAGGACATGACGGAGGAGGAGCAGCAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6il331gn