gtf3c3

Ensembl ID:
ENSDARG00000043247
ZFIN ID:
ZDB-GENE-040914-80
Description:
Im:7136784 protein [Source:UniProtKB/TrEMBL;Acc:Q5BLI4]
Human Orthologue:
GTF3C3
Human Description:
general transcription factor IIIC, polypeptide 3, 102kDa [Source:HGNC Symbol;Acc:4666]
Mouse Orthologue:
Gtf3c3
Mouse Description:
general transcription factor IIIC, polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:2138383]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25515 Nonsense Mutation detected in F1 DNA During 2017
sa32582 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127329 Nonsense 9 334 1 7
Genomic Location (Zv9):
Chromosome 1 (position 5125580)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5564042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCTCTTGCTTTCTCAAGGACGGATGGATGATTACATTGATACAGTAT[T/A]GACCATGCTGTCCATGTTTCTTAAGGTCAGAACACGTGATATAAATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127329 Nonsense 329 334 7 7
Genomic Location (Zv9):
Chromosome 1 (position 5135977)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 5574439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATTTACCAGTCCAGTGGTAATAAGGACATGGCCCGACACATCATCTA[T/A]ACTTACTGTACTATATGATCCTGTGATCCCATCTAATGTTGCTTTTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link