arrb1

Ensembl ID:
ENSDARG00000043241
ZFIN IDs:
ZDB-GENE-060824-1, ZDB-GENE-060824-1
Description:
beta-arrestin-1 [Source:RefSeq peptide;Acc:NP_001153294]
Human Orthologue:
ARRB1
Human Description:
arrestin, beta 1 [Source:HGNC Symbol;Acc:711]
Mouse Orthologue:
Arrb1
Mouse Description:
arrestin, beta 1 Gene [Source:MGI Symbol;Acc:MGI:99473]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42479 Nonsense Mutation detected in F1 DNA During 2016
sa662 Nonsense F2 line generated During 2016
sa11194 Nonsense Available for shipment Available now
sa42478 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123839 Nonsense 109 157 5 15
ENSDART00000129080 Nonsense 109 418 5 16
Genomic Location (Zv9):
Chromosome 15 (position 5284685)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5419511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGAAAAAGAGCCTGACACGTCTACAAGAGCGACTGATAAAGAAACTC[G/T]GAGAGCATGCCTACCCCTTCACCTTTGAGGTCAAACTACTCTCATTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa662
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123839 Nonsense 113 157 5 15
ENSDART00000129080 Nonsense 113 418 5 16
Genomic Location (Zv9):
Chromosome 15 (position 5284671)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5419497
KASP Assay ID:
554-0570.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACACGTCTACAAGAGCGACTGATAAAGAAACTCGGAGAGCATGCCTA[C/A]CCCTTCACCTTTGAGGTCAAACTACTCTCATTTATCTTCATTTAATGCCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123839 Nonsense 130 157 6 15
ENSDART00000129080 Nonsense 130 418 6 16
Genomic Location (Zv9):
Chromosome 15 (position 5284030)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5418856
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATCTTTCCTCACAGATTCCTCCAAACTTACCCTGTTCTGTCACATTA[C/T]AACCAGGGCCAGAAGATACAGGAAAGGTATATTTCCTTTGAATAATAATW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123839   None 157 13 15
ENSDART00000129080 Essential Splice Site 341 418 None 16
Genomic Location (Zv9):
Chromosome 15 (position 5269036)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5403926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGCATGTCTAGTGGATGCCTCACTGCCATGATTTATGTCTCCCTCTGC[A/T]GTGATGTTGCCGTCGAGCTCCCCTTTACATTAATGCATCCTAAACCATTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link