arrb1

Ensembl ID:
ENSDARG00000043241
ZFIN IDs:
ZDB-GENE-060824-1, ZDB-GENE-060824-1
Description:
beta-arrestin-1 [Source:RefSeq peptide;Acc:NP_001153294]
Human Orthologue:
ARRB1
Human Description:
arrestin, beta 1 [Source:HGNC Symbol;Acc:711]
Mouse Orthologue:
Arrb1
Mouse Description:
arrestin, beta 1 Gene [Source:MGI Symbol;Acc:MGI:99473]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa662 Nonsense F2 line generated During 2014
sa11194 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa662
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123839 Nonsense 113 157 5 15
ENSDART00000129080 Nonsense 113 418 5 16
Genomic Location:
Chromosome 15 (position 5284671)
KASP Assay ID:
554-0570.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACACGTCTACAAGAGCGACTGATAAAGAAACTCGGAGAGCATGCCTA[C/A]CCCTTCACCTTTGAGGTCAAACTACTCTCATTTATCTTCATTTAATGCCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123839 Nonsense 130 157 6 15
ENSDART00000129080 Nonsense 130 418 6 16
Genomic Location:
Chromosome 15 (position 5284030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATCTTTCCTCACAGATTCCTCCAAACTTACCCTGTTCTGTCACATTA[C/T]AACCAGGGCCAGAAGATACAGGAAAGGTATATTTCCTTTGAATAATAATW
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2b7yiuj6