NP_001183994.1

Ensembl ID:
ENSDARG00000043237
Description:
E4 binding protein 4-2 [Source:RefSeq peptide;Acc:NP_001183994]
Human Orthologue:
NFIL3
Human Description:
nuclear factor, interleukin 3 regulated [Source:HGNC Symbol;Acc:7787]
Mouse Orthologue:
Nfil3
Mouse Description:
nuclear factor, interleukin 3, regulated Gene [Source:MGI Symbol;Acc:MGI:109495]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33110 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063478 Nonsense 298 541 1 1
Genomic Location (Zv9):
Chromosome 3 (position 13875965)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13934252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGCATTGCCTCATATCCGGTGGAAAGTCAGGACATTATTCCACAAGAA[C/T]AGCAGAACTTCACTCAGGCTACAGAGGAACAGAGCAGAAGCCTGGTTTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link