ccna1

Ensembl ID:
ENSDARG00000043236
ZFIN ID:
ZDB-GENE-040311-2
Description:
cyclin-A1 [Source:RefSeq peptide;Acc:NP_997983]
Human Orthologue:
CCNA1
Human Description:
cyclin A1 [Source:HGNC Symbol;Acc:1577]
Mouse Orthologue:
Ccna1
Mouse Description:
cyclin A1 Gene [Source:MGI Symbol;Acc:MGI:108042]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11172 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002166 Nonsense 151 391 5 9
ENSDART00000141201 Nonsense 151 281 4 5
Genomic Location (Zv9):
Chromosome 10 (position 35936696)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34969398
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARTTTGTTTTGCTCTGCATCTACACTTTTTTTTTTTTTGTGCTTCAGGTT[A/T]AATACAGACCAAAACCYGGCTATATGAGAAAGCAGCCTGACATAACCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link