ccna1

Ensembl ID:
ENSDARG00000043236
ZFIN ID:
ZDB-GENE-040311-2
Description:
cyclin-A1 [Source:RefSeq peptide;Acc:NP_997983]
Human Orthologue:
CCNA1
Human Description:
cyclin A1 [Source:HGNC Symbol;Acc:1577]
Mouse Orthologue:
Ccna1
Mouse Description:
cyclin A1 Gene [Source:MGI Symbol;Acc:MGI:108042]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7649 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11172 Nonsense Available for shipment Available now
sa4380 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7649
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002166 Essential Splice Site None 391 1 9
ENSDART00000141201 None None 281 1 5
Genomic Location:
Chromosome 10 (position 35939253)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MTCCACTGARAGTTCATACGTTTAAAAAAANNNGTTTGACGATATAAAAG[G/A]TTTGTTTTRAATGGTTCGGTTTTAAATATYAACTTTAATTTATTACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002166 Nonsense 151 391 5 9
ENSDART00000141201 Nonsense 151 281 4 5
Genomic Location:
Chromosome 10 (position 35936696)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARTTTGTTTTGCTCTGCATCTACACTTTTTTTTTTTTTGTGCTTCAGGTT[A/T]AATACAGACCAAAACCYGGCTATATGAGAAAGCAGCCTGACATAACCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002166 Essential Splice Site 375 391 8 9
ENSDART00000141201 None None 281 None 5
Genomic Location:
Chromosome 10 (position 35932696)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAAGTCGCCCTCAACAGGCCATCCAGGAGAAGTACAAGAGCTCGAAG[T/C]AAGCATACCTTTTTGTTATGGGTGTAGTTTTGTACCTTTTTTAAGGCGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vbtud7ej