nfix

Ensembl ID:
ENSDARG00000043226
ZFIN ID:
ZDB-GENE-080722-15
Description:
Novel protein similar to vertebrate nuclear factor I/X (CCAAT-binding transcription factor) (NFIX) [
Human Orthologue:
NFIX
Human Description:
nuclear factor I/X (CCAAT-binding transcription factor) [Source:HGNC Symbol;Acc:7788]
Mouse Orthologue:
Nfix
Mouse Description:
nuclear factor I/X Gene [Source:MGI Symbol;Acc:MGI:97311]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19599 Essential Splice Site Available for shipment Available now
sa39695 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121795 Essential Splice Site 208 542 3 13
ENSDART00000135861   None 186 None 2
Genomic Location (Zv9):
Chromosome 1 (position 52543096)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51414566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAATTCCAGTCAACAAGGAGACTCGGACATCAAACCCCCACCAAACGG[T/A]GAGAAAACAACAGGCGAACTGATTTATACATTATTATACTGGCCAAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121795 Essential Splice Site 353 542 8 13
ENSDART00000135861   None 186 None 2
Genomic Location (Zv9):
Chromosome 1 (position 52550797)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51422267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAGGAAGATAAAGCATGAGAATGACGGCGTGCAGTTTCCTTACCATG[G/T]TTAGAAGACACAACACACACACACATGCACACGGGCAGAGGAAGCAGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link