kcnh5a

Ensembl ID:
ENSDARG00000043220
ZFIN ID:
ZDB-GENE-061106-2
Description:
potassium voltage-gated channel subfamily H member 5 [Source:RefSeq peptide;Acc:NP_001038263]
Human Orthologue:
KCNH5
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 5 [Source:HGNC Symbol;Acc:6254]
Mouse Orthologue:
Kcnh5
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 5 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23671 Nonsense Mutation detected in F1 DNA During 2016
sa10289 Essential Splice Site Available for shipment Available now
sa39274 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43412 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029689 Nonsense 173 1001 5 12
ENSDART00000103532 Nonsense 173 1093 5 12
ENSDART00000131859 Nonsense 172 1000 5 12
Genomic Location (Zv9):
Chromosome 20 (position 20188591)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20216758
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACCAACAGCCGAGGTACGGTTCAGCAGCTCACCCCCATGAACAAGACT[G/T]AAGTCAGTCACAAGCATTCACGACTGGCAGAGGTGAGTGTCATATACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029689 Essential Splice Site 524 1001 8 12
ENSDART00000103532 Essential Splice Site 555 1093 9 12
ENSDART00000131859 Essential Splice Site 523 1000 8 12
Genomic Location (Zv9):
Chromosome 20 (position 20099156)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20127323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACATCGTGTCCACGTGGGCCATGACTAAAGGCATAGACACAGARAAGG[T/C]GTGTGAATCTTCAACTCTTCCTTTTATTGGTGTACCTTACTCGTATACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39274
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029689 Essential Splice Site 675 1001 None 12
ENSDART00000103532 Essential Splice Site 706 1093 None 12
ENSDART00000131859 Essential Splice Site 674 1000 None 12
Genomic Location (Zv9):
Chromosome 20 (position 20038251)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20066418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAAACTAAAGTGCTACCCAGATTTCTTATACATCTTTATGTCTTCAC[A/T]GATTGTTTTCCGCAAGATTGCAGATGTAAAGAAGGAGGAAGAAGAGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029689 Nonsense 832 1001 12 12
ENSDART00000103532 Nonsense 924 1093 12 12
ENSDART00000131859 Nonsense 831 1000 12 12
Genomic Location (Zv9):
Chromosome 20 (position 20037595)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 20065762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGGGATGTATCTCAGCCCCTGAATGCAATCTCAGAGGACAGGAAGGGC[C/T]AGGAAGCAGAGGGTGGTGGGTCCCAGAAAGAGGGTCCCAGTGGAAACAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link