kcnh5a

Ensembl ID:
ENSDARG00000043220
ZFIN ID:
ZDB-GENE-061106-2
Description:
potassium voltage-gated channel subfamily H member 5 [Source:RefSeq peptide;Acc:NP_001038263]
Human Orthologue:
KCNH5
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 5 [Source:HGNC Symbol;Acc:6254]
Mouse Orthologue:
Kcnh5
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 5 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23671 Nonsense Mutation detected in F1 DNA During 2014
sa10289 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029689 Nonsense 173 1001 5 12
ENSDART00000103532 Nonsense 173 1093 5 12
ENSDART00000131859 Nonsense 172 1000 5 12
Genomic Location:
Chromosome 20 (position 20188591)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACCAACAGCCGAGGTACGGTTCAGCAGCTCACCCCCATGAACAAGACT[G/T]AAGTCAGTCACAAGCATTCACGACTGGCAGAGGTGAGTGTCATATACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029689 Essential Splice Site 524 1001 8 12
ENSDART00000103532 Essential Splice Site 555 1093 9 12
ENSDART00000131859 Essential Splice Site 523 1000 8 12
Genomic Location:
Chromosome 20 (position 20099156)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACATCGTGTCCACGTGGGCCATGACTAAAGGCATAGACACAGARAAGG[T/C]GTGTGAATCTTCAACTCTTCCTTTTATTGGTGTACCTTACTCGTATACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u4rp6gcy