adam17a

Ensembl ID:
ENSDARG00000043213
ZFIN ID:
ZDB-GENE-030131-2862
Description:
a disintegrin and metalloproteinase domain 17a [Source:RefSeq peptide;Acc:NP_955967]
Human Orthologue:
ADAM17
Human Description:
ADAM metallopeptidase domain 17 [Source:HGNC Symbol;Acc:195]
Mouse Orthologue:
Adam17
Mouse Description:
a disintegrin and metallopeptidase domain 17 Gene [Source:MGI Symbol;Acc:MGI:1096335]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42975 Nonsense Mutation detected in F1 DNA During 2016
sa15007 Nonsense Available for shipment Available now
sa17758 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063437 Nonsense 263 842 7 19
Genomic Location (Zv9):
Chromosome 17 (position 35438528)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35323452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAATTGCTAAATATTTATTGAATTGATGTGTTTTGTGTTGTTTAGATC[G/T]AGCTGATAGACAGAGTGGATGATATCTACAGGAACACATCCTGGGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063437 Nonsense 295 842 8 19
Genomic Location (Zv9):
Chromosome 17 (position 35437218)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35322142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTATGAATGTTATCTAATATGTAAATATSCCCACAGATAATCATAAAC[A/T]AGGATCCCACAAAAGTTGCCCCTGGAGAGTTTCACTACAACATGGATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063437 Nonsense 388 842 10 19
Genomic Location (Zv9):
Chromosome 17 (position 35433959)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 35318883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWTYACCTTGCAGCCTACTATCCATCACAGTCTGTCAAGAAACCCAGTTA[T/A]CTAAACACCGGCTTGACGAGCACCATGAACTATGGGAAAAYCATTCTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link