adam17a

Ensembl ID:
ENSDARG00000043213
ZFIN ID:
ZDB-GENE-030131-2862
Description:
a disintegrin and metalloproteinase domain 17a [Source:RefSeq peptide;Acc:NP_955967]
Human Orthologue:
ADAM17
Human Description:
ADAM metallopeptidase domain 17 [Source:HGNC Symbol;Acc:195]
Mouse Orthologue:
Adam17
Mouse Description:
a disintegrin and metallopeptidase domain 17 Gene [Source:MGI Symbol;Acc:MGI:1096335]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15007 Nonsense Available for shipment Available now
sa17758 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063437 Nonsense 295 842 8 19
Genomic Location:
Chromosome 17 (position 35437218)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTATGAATGTTATCTAATATGTAAATATSCCCACAGATAATCATAAAC[A/T]AGGATCCCACAAAAGTTGCCCCTGGAGAGTTTCACTACAACATGGATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063437 Nonsense 388 842 10 19
Genomic Location:
Chromosome 17 (position 35433959)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWTYACCTTGCAGCCTACTATCCATCACAGTCTGTCAAGAAACCCAGTTA[T/A]CTAAACACCGGCTTGACGAGCACCATGAACTATGGGAAAAYCATTCTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/67q8vqtl