ripk4

Ensembl ID:
ENSDARG00000043211
ZFIN ID:
ZDB-GENE-040426-2042
Description:
receptor-interacting serine/threonine-protein kinase 4 [Source:RefSeq peptide;Acc:NP_998243]
Human Orthologue:
RIPK4
Human Description:
receptor-interacting serine-threonine kinase 4 [Source:HGNC Symbol;Acc:496]
Mouse Orthologue:
Ripk4
Mouse Description:
receptor-interacting serine-threonine kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1919638]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5831 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063434 Essential Splice Site 224 820 4 8
ENSDART00000128181 Essential Splice Site 239 835 5 9
ENSDART00000131291 Essential Splice Site 196 792 4 8
Genomic Location (Zv9):
Chromosome 10 (position 36151630)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35184332
KASP Assay ID:
554-3728.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCCATTGTTATCTGGGGAATTCTCACACAGAAGAAGCCATATCAAG[G/A]TAAGAGGAGAAATAAAAGTGAAAAGATTAAAAGYGAAAGTATGTGTAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link