nsun5

Ensembl ID:
ENSDARG00000043209
ZFIN ID:
ZDB-GENE-040426-2476
Description:
NOP2/Sun domain family, member 5 [Source:RefSeq peptide;Acc:NP_998450]
Human Orthologue:
NSUN5
Human Description:
NOP2/Sun domain family, member 5 [Source:HGNC Symbol;Acc:16385]
Mouse Orthologue:
Nsun5
Mouse Description:
NOL1/NOP2/Sun domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:2140844]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12468 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063418 Nonsense 158 435 4 10
ENSDART00000063425 Nonsense 158 483 4 11
ENSDART00000113239 Nonsense 158 483 4 11
ENSDART00000129341 Nonsense 149 474 4 11

The following transcripts of ENSDARG00000043209 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 36178881)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35211583
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAACATCTCTGGAAGATGTCATYGACTATTTAAAACGAGAGGGCTTTT[C/A]GTATCAAGGGACGCCWGGACGGTTTGTTGCTTTCTACACTCCACAAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link