mllt1

Ensembl ID:
ENSDARG00000043185
ZFIN ID:
ZDB-GENE-081105-45
Description:
Novel protein similar to human myeloid/lymphoid protein family [Source:UniProtKB/TrEMBL;Acc:B0S7E6]
Human Orthologue:
MLLT1
Human Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 [Sour
Mouse Orthologue:
Mllt1
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 Gene

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5476 Nonsense Mutation detected in F1 DNA During 2014
sa11638 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063400 Nonsense 71 582 3 12
ENSDART00000141113 Nonsense 67 575 2 11
Genomic Location:
Chromosome 8 (position 20753988)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTAATTATTCTTTTTGTATTTATGTGCAGTGTGTAAGGAGCCCCAATA[C/A]AAGGTTGAGGAGTCRGGTTATGCTGGYTTTCTGAKGCCCATAGAGGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063400 Essential Splice Site 182 582 5 12
ENSDART00000141113 Essential Splice Site 178 575 4 11
Genomic Location:
Chromosome 8 (position 20750521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGCCTTTTCAGACCCCAAGAAGAGCAAGACCTCACAAGGATCAAAGG[T/A]CAGTAAAAGGAGAAATAAGCCATTCTCAGTCWGAATGATACTCTTTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/495jc8pd