si:dkey-220o5.3

Ensembl ID:
ENSDARG00000043179
ZFIN ID:
ZDB-GENE-030131-5484
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JJ17]
Human Orthologue:
BAG4
Human Description:
BCL2-associated athanogene 4 [Source:HGNC Symbol;Acc:940]
Mouse Orthologue:
Bag4
Mouse Description:
BCL2-associated athanogene 4 Gene [Source:MGI Symbol;Acc:MGI:1914634]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21369 Nonsense Available for shipment Available now
sa10354 Nonsense Available for shipment Available now
sa11414 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063396 Nonsense 124 399 3 5
Genomic Location (Zv9):
Chromosome 8 (position 46936456)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44610627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTACATCCTTCTAATCCATTCTACTGCAGTGACCAGGTTCCTTCAAGA[C/T]AACCTCATTATCACAACCAATCCTGCCCTGAACAGAATGCAGGGGGCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10354
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063396 Nonsense 145 399 3 5
Genomic Location (Zv9):
Chromosome 8 (position 46936521)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44610562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCAATCCTGCCCTGAACAGAATGCAGGGGGCTCGACTCATCCCCCCTA[C/A]CCTGTACCTCACTGCCAAGCGGTAAATTCAGCTACATATAAGGATAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063396 Nonsense 215 399 4 5
Genomic Location (Zv9):
Chromosome 8 (position 46938812)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44608271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCTCAGCAGCAATGGCCTTCTGATTCCCAGACACCCCATAGCCACTA[T/A]GGCAGTCATGTACGACCACCTCACCCCCCTCCATGGCAAGGACCYRCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link