dnajb13

Ensembl ID:
ENSDARG00000043157
ZFIN ID:
ZDB-GENE-040910-4
Description:
dnaJ homolog subfamily B member 13 [Source:RefSeq peptide;Acc:NP_001017606]
Human Orthologue:
DNAJB13
Human Description:
DnaJ (Hsp40) homolog, subfamily B, member 13 [Source:HGNC Symbol;Acc:30718]
Mouse Orthologue:
Dnajb13
Mouse Description:
DnaJ (Hsp40) related, subfamily B, member 13 Gene [Source:MGI Symbol;Acc:MGI:1916637]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18993 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063365 Essential Splice Site 112 322 None 8
ENSDART00000148093 Essential Splice Site 112 322 None 8

The following transcripts of ENSDARG00000043157 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37924738)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36736899
KASP Assay ID:
2261-7166.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATGAAACATTTCGACAGTTTTTCGGAGGAGATAATCCTTTTGCAGG[T/C]TATTTTTTAAGGGATGAAAACACTCTCAAATGACTGATCATCTACGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link