LOC560410

Ensembl ID:
ENSDARG00000043141
Human Orthologue:
ADCY8
Human Description:
adenylate cyclase 8 (brain) [Source:HGNC Symbol;Acc:239]
Mouse Orthologue:
Adcy8
Mouse Description:
adenylate cyclase 8 Gene [Source:MGI Symbol;Acc:MGI:1341110]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12806 Nonsense Available for shipment Available now
sa10036 Nonsense Available for shipment Available now
sa9784 Nonsense Available for shipment Available now
sa36463 Nonsense Mutation detected in F1 DNA During 2016
sa42967 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045040 Nonsense 42 1183 1 18
Genomic Location (Zv9):
Chromosome 17 (position 33519506)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33361237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGCAAGCAACTAATGTGGCAGAATGCTGTACGTCACATTATTGACCAA[C/T]GAGGAAWGCACCACGAGGGGCGAGCGGKCAACTCTCGCAAAATCATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10036
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045040 Nonsense 69 1183 1 18
Genomic Location (Zv9):
Chromosome 17 (position 33519587)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33361318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTCGCAAAATCATTGTTACTGACGCCTACATCGATGACATCAACAGA[C/T]AGATTCGGAACAAAGCTGCACGGGGCAATGCTGGCATGCATAAGCGGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045040 Nonsense 217 1183 1 18
Genomic Location (Zv9):
Chromosome 17 (position 33520033)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33361764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTAGTTMTGACTTGTAAAGGACTGATGTCTCCAGATTACCTTCGCTA[T/A]GCCGGGCTGGCAAGCTGGCTGTCACAGACTGTTCAAGCGCTGGGGGGRCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045040 Nonsense 924 1183 14 18
Genomic Location (Zv9):
Chromosome 17 (position 33533597)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33375328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTCTGCTGTACAACATCCTCCCTGCCCACGTCGCTCGCCACTTTCTC[G/T]AGAGAGACAGAAACAATGAGGTACAGTAGTAACCGCATTTATAGTCCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045040 Nonsense 1168 1183 18 18
Genomic Location (Zv9):
Chromosome 17 (position 33544098)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33385829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACACTCTCGCCGCTGTGGTCTTTTCCCTGGTGCAGGCCCGCAAGAAA[G/T]AAGAATTACGAGAAGCCAATGGAGGATTTCATCTGAAGGACATGGCATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link