cdca8

Ensembl ID:
ENSDARG00000043137
ZFIN ID:
ZDB-GENE-041114-171
Description:
Borealin [Source:UniProtKB/Swiss-Prot;Acc:Q5XLR4]
Human Orthologue:
CDCA8
Human Description:
cell division cycle associated 8 [Source:HGNC Symbol;Acc:14629]
Mouse Orthologue:
Cdca8
Mouse Description:
cell division cycle associated 8 Gene [Source:MGI Symbol;Acc:MGI:1196274]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43351 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43350 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063337 Essential Splice Site 193 276 8 11
Genomic Location (Zv9):
Chromosome 19 (position 49499384)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48149405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCAATCATCGGTGCCACACCGCTCATCACGCCGCGCTTTGACCCCAG[G/A]TGAATTCACAACACTGCATTTTCATGACACTGTTGATTAAAACTGCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43350
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063337 Essential Splice Site 236 276 9 11
Genomic Location (Zv9):
Chromosome 19 (position 49496819)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48151970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCGGTGGAGAAGACATCGTCATCAGTGTCCCGATCGGAAACGGAGAG[G/A]TAGATGGTGATCCTGATGCTCATTAAGCACAGCTCAGTGTTTGTGTGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link