cutl1

Ensembl ID:
ENSDARG00000043134
ZFIN ID:
ZDB-GENE-040801-260
Description:
cut-like 1 [Source:RefSeq peptide;Acc:NP_001003514]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa123 Nonsense Available for shipment Available now
sa12586 Nonsense Available for shipment Available now
sa22576 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063329 Nonsense 9 672 1 23
ENSDART00000138469 None None 273 None 10
Genomic Location:
Chromosome 15 (position 2511451)
KASP Assay ID:
554-0920.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCGTGAGAGATGAGGAAGAAAGATGGCGGCCAGCGCGATGTCGATGTG[T/A]CAGTTTTGGAAACGCTTTGACTTGGTTCAGTTGCAGGTCAGTGACTATCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa12586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063329 Nonsense 334 672 11 23
ENSDART00000138469 None None 273 None 10
Genomic Location:
Chromosome 15 (position 2524510)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGAGRCTGCAGGCCAGCCTCTCCGCTCTCAGAGAAAACACACACACA[C/T]AGATCAGCCAGTTACAGCAGCAGCTCASCATGAAGACCACTGCACTCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063329 Essential Splice Site 419 672 14 23
ENSDART00000138469 Essential Splice Site 47 273 2 10
Genomic Location:
Chromosome 15 (position 2526024)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGTCTGAGAACGCGTCTCTGCGCATCGCTAACACTGAGCTGAGTGG[T/A]GAGTAATTTGCATAGTACACGCCCAAACCATCTCCATATAAGGGCTTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vc96ks8f