ctsz

Ensembl ID:
ENSDARG00000043081
ZFIN ID:
ZDB-GENE-041010-139
Description:
cathepsin Z [Source:RefSeq peptide;Acc:NP_001006043]
Human Orthologue:
CTSZ
Human Description:
cathepsin Z [Source:HGNC Symbol;Acc:2547]
Mouse Orthologue:
Ctsz
Mouse Description:
cathepsin Z Gene [Source:MGI Symbol;Acc:MGI:1891190]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31540 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063251 Nonsense 51 301 2 6

The following transcripts of ENSDARG00000043081 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 49724919)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49774600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTATGCGTTTTACAGGACTGGACCACGTCCTTATGAGTCTATGAATT[T/A]GAAAGAACTGCCCAAAGAGTGGGACTGGAGAAACATCAAAGGCGTCAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link