fbxl5

Ensembl ID:
ENSDARG00000043046
ZFIN IDs:
ZDB-GENE-030131-900, ZDB-GENE-030131-900
Description:
F-box/LRR-repeat protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q2YDQ5]
Human Orthologue:
FBXL5
Human Description:
F-box and leucine-rich repeat protein 5 [Source:HGNC Symbol;Acc:13602]
Mouse Orthologue:
Fbxl5
Mouse Description:
F-box and leucine-rich repeat protein 5 Gene [Source:MGI Symbol;Acc:MGI:2152883]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4247 Nonsense Mutation detected in F1 DNA During 2014
sa24418 Nonsense Mutation detected in F1 DNA During 2014
sa7510 Missense Mutation detected in F1 DNA During 2014
sa5066 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102891 Nonsense 1 694 1 12
ENSDART00000123100 None None 679 None 11
Genomic Location:
Chromosome 23 (position 46157677)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGTGCAGATGTTCAGCGTCRGCAGAGGRTTTTGAGCTGGAGGATCTG[G/A]CGCCCGCGTGTTCAGTCCGCGGCAGTGGAGCTGATGGAGGCGCRATGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102891 Nonsense 16 694 1 12
ENSDART00000123100 None 1 679 1 11
Genomic Location:
Chromosome 23 (position 46157634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCTGGCGCCCGCGTGTTCAGTCCGCGGCAGTGGAGCTGATGGAGGCG[C/T]GATGGCTCCTTTTCCCGATGAGGTGGATGTTTTCACGGGCCCTCACTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102891 Missense 32 694 2 12
ENSDART00000123100 Missense 17 679 1 11
Genomic Location:
Chromosome 23 (position 46157584)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRATGGCTCCTTTTCCCGATGAGGTGGATGTTTTCACGGGCCCTCACTGG[C/T]GCATGAAGCAGCTGGTGGGTCTTTACAGCGAAAAGGTTCGTCTWTTACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102891 Nonsense 222 694 6 12
ENSDART00000123100 Nonsense 207 679 5 11
Genomic Location:
Chromosome 23 (position 46152364)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTGTGTGTNNNNNNNNNNCCTCAGAGCGTGTGTTGGAGCGTGTGT[C/A]GGTGTCGTCTCTCCCRCAGGAGCTGCTTCTGCGTATCTTCAGGTTTCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/42pstyo3