fbxl5

Ensembl ID:
ENSDARG00000043046
ZFIN IDs:
ZDB-GENE-030131-900, ZDB-GENE-030131-900
Description:
F-box/LRR-repeat protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q2YDQ5]
Human Orthologue:
FBXL5
Human Description:
F-box and leucine-rich repeat protein 5 [Source:HGNC Symbol;Acc:13602]
Mouse Orthologue:
Fbxl5
Mouse Description:
F-box and leucine-rich repeat protein 5 Gene [Source:MGI Symbol;Acc:MGI:2152883]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24418 Nonsense Available for shipment Available now
sa44065 Nonsense Mutation detected in F1 DNA During 2016
sa7510 Missense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102891 Nonsense 16 694 1 12
ENSDART00000123100   1 679 1 11
Genomic Location (Zv9):
Chromosome 23 (position 46157634)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46024253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCTGGCGCCCGCGTGTTCAGTCCGCGGCAGTGGAGCTGATGGAGGCG[C/T]GATGGCTCCTTTTCCCGATGAGGTGGATGTTTTCACGGGCCCTCACTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102891 Nonsense 31 694 2 12
ENSDART00000123100 Nonsense 16 679 1 11
Genomic Location (Zv9):
Chromosome 23 (position 46157586)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46024301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGATGGCTCCTTTTCCCGATGAGGTGGATGTTTTCACGGGCCCTCACT[G/A]GCGCATGAAGCAGCTGGTGGGTCTTTACAGCGAAAAGGTTCGTCTATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102891 Missense 32 694 2 12
ENSDART00000123100 Missense 17 679 1 11
Genomic Location (Zv9):
Chromosome 23 (position 46157584)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 46024303
KASP Assay ID:
554-4192.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRATGGCTCCTTTTCCCGATGAGGTGGATGTTTTCACGGGCCCTCACTGG[C/T]GCATGAAGCAGCTGGTGGGTCTTTACAGCGAAAAGGTTCGTCTWTTACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link