si:dkey-12h9.9

Ensembl ID:
ENSDARG00000043035
ZFIN ID:
ZDB-GENE-041001-149
Description:
Novel protein similar to vertebrate calpain 3, (P94) (CAPN3) [Source:UniProtKB/TrEMBL;Acc:Q5SNR7]
Human Orthologue:
CAPN3
Human Description:
calpain 3, (p94) [Source:HGNC Symbol;Acc:1480]
Mouse Orthologue:
Capn3
Mouse Description:
calpain 3 Gene [Source:MGI Symbol;Acc:MGI:107437]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15564 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063177 Essential Splice Site 202 533 4 12
ENSDART00000136518 Essential Splice Site 202 719 4 20
Genomic Location (Zv9):
Chromosome 20 (position 26023593)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26094896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACAGAATAATGAATTTTGGAGTGCTCTCATGGAAAAGGCATATGCAAA[G/A]TAAGTTCATTTATTACAATATTTGGCATCAATAACGCTATACTGTGTCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link