Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-12h9.9
- Ensembl ID:
- ENSDARG00000043035
- ZFIN ID:
- ZDB-GENE-041001-149
- Description:
- Novel protein similar to vertebrate calpain 3, (P94) (CAPN3) [Source:UniProtKB/TrEMBL;Acc:Q5SNR7]
- Human Orthologue:
- CAPN3
- Human Description:
- calpain 3, (p94) [Source:HGNC Symbol;Acc:1480]
- Mouse Orthologue:
- Capn3
- Mouse Description:
- calpain 3 Gene [Source:MGI Symbol;Acc:MGI:107437]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa15564 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15564
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000063177 | Essential Splice Site | 202 | 533 | 4 | 12 |
| ENSDART00000136518 | Essential Splice Site | 202 | 719 | 4 | 20 |
- Genomic Location (Zv9):
- Chromosome 20 (position 26023593)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 26094896 GRCz11 20 25993986 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGACAGAATAATGAATTTTGGAGTGCTCTCATGGAAAAGGCATATGCAAA[G/A]TAAGTTCATTTATTACAATATTTGGCATCAATAACGCTATACTGTGTCAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
