ENSDARG00000043034

Ensembl ID:
ENSDARG00000043034
Human Orthologue:
MCOLN1
Human Description:
mucolipin 1 [Source:HGNC Symbol;Acc:13356]
Mouse Orthologue:
Mcoln1
Mouse Description:
mucolipin 1 Gene [Source:MGI Symbol;Acc:MGI:1890498]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24416 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063175 Nonsense 351 513 11 14
Genomic Location:
Chromosome 23 (position 44972093)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTATGTTGTGTGTGTGTTGTGTTGTTCAGATCCTCATCATTACTCTG[C/T]GAGTGGCTCTGCCGAATGTGATCCGCTTCACCTGCTGCGCTGCGATGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vfi9a2wx