ENSDARG00000043034

Ensembl ID:
ENSDARG00000043034
Human Orthologue:
MCOLN1
Human Description:
mucolipin 1 [Source:HGNC Symbol;Acc:13356]
Mouse Orthologue:
Mcoln1
Mouse Description:
mucolipin 1 Gene [Source:MGI Symbol;Acc:MGI:1890498]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24416 Nonsense Available for shipment Available now
sa32469 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063175 Nonsense 351 513 11 14
Genomic Location (Zv9):
Chromosome 23 (position 44972093)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43773555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTATGTTGTGTGTGTGTTGTGTTGTTCAGATCCTCATCATTACTCTG[C/T]GAGTGGCTCTGCCGAATGTGATCCGCTTCACCTGCTGCGCTGCGATGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063175 Nonsense 496 513 14 14
Genomic Location (Zv9):
Chromosome 23 (position 44968918)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43770380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGAGTTCAGTGTGGAGAAAACCAACAGCATCAGCAGCACAGGAGGA[G/T]GAAAACTGATGTGCTGCTGCTCACACAGGTACTCACACACACAAATGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link