ints10

Ensembl ID:
ENSDARG00000043031
ZFIN IDs:
ZDB-GENE-050522-2, ZDB-GENE-050522-2
Description:
Integrator complex subunit 10 [Source:UniProtKB/Swiss-Prot;Acc:Q6TNU3]
Human Orthologue:
INTS10
Human Description:
integrator complex subunit 10 [Source:HGNC Symbol;Acc:25548]
Mouse Orthologue:
Ints10
Mouse Description:
integrator complex subunit 10 Gene [Source:MGI Symbol;Acc:MGI:1918135]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35614 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35614
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082017 Nonsense 47 277 2 9
ENSDART00000122374 Nonsense 47 715 2 18
Genomic Location (Zv9):
Chromosome 14 (position 714539)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 694911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCTGTGCACTGATGTGTGTTTTGTTGTTGTGTGCAGTATGAGATGTA[C/A]AGTATTGAGCGTAACGCTGAGAGGACGAGCTCTGCTGGCCGACTGCTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link