sema6a

Ensembl ID:
ENSDARG00000043028
ZFIN ID:
ZDB-GENE-030131-8004
Description:
semaphorin-6A [Source:RefSeq peptide;Acc:NP_956286]
Human Orthologue:
SEMA6A
Human Description:
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A [Source:HGNC Symbol;
Mouse Orthologue:
Sema6a
Mouse Description:
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A Gene [Source:MGI Sym

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21165 Nonsense Available for shipment Available now
sa34267 Nonsense Mutation detected in F1 DNA During 2017
sa41095 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21166 Nonsense Available for shipment Available now
sa16622 Essential Splice Site Available for shipment Available now
sa38661 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21165
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063167 Nonsense 4 967 1 21
Genomic Location (Zv9):
Chromosome 8 (position 241150)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149932.1 63130
KASP Assay ID:
2259-9905.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGGCTGAAGTTAAGAAGAGATCGTGCGGGACAGTAAAGATGCGAGCG[C/T]AGGCCCTGCTGCTGTACCTGACGCTGCTGCAGACGGCTGGAGCCGCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063167 Nonsense 9 967 1 21
Genomic Location (Zv9):
Chromosome 8 (position 241167)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149932.1 63147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGATCGTGCGGGACAGTAAAGATGCGAGCGCAGGCCCTGCTGCTGTA[C/A]CTGACGCTGCTGCAGACGGCTGGAGCCGCTTTCCCAGAAGACACCGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063167 Essential Splice Site 72 967 3 21
Genomic Location (Zv9):
Chromosome 8 (position 241715)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149932.1 63695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACACCAGCTGATCGTCATCATGAACCGGACGCTGTATGTGGCTGCGAG[G/A]TGAGTCTGATCTTCATCATCACTCCTGATCTGAGAACGCAGACAGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21166
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063167 Nonsense 227 967 9 21
Genomic Location (Zv9):
Chromosome 8 (position 262949)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149932.1 84929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTGCTCCTCCTGCTTGCAGAGCCGTATTTCGTGCAGGCGGTGGATTA[C/A]GAGGACTTCATCTACTTCTTCTTTCGGGAAATCGCCATGGAGTACAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063167 Essential Splice Site 547 967 15 21
Genomic Location (Zv9):
Chromosome 8 (position 271989)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150518.1 36047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGGCTGGGTGTCCGAGGGCGCCTGCAGAGAAATCACATCTGATGCAAA[G/T]TAAGTGCCTCRCTCTCAGGCCTGTAATTATAGATCASAGCCGCCAGCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063167 Nonsense 752 967 21 21
Genomic Location (Zv9):
Chromosome 8 (position 289795)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150518.1 18241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCGAGTCCACACCACTGCAGCCACGCCGCAAGCCTAGCAGGGGGAGC[C/T]GAGAGTGGGAGCGCAACCAGAACCTGATCAACGCCTGCACCAAAGAGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Amyotrophic lateral sclerosis: Reduced expression of the Kinesin-Associated Protein 3 (KIFAP3) gene increases survival in sporadic amyotrophic lateral sclerosis. (View Study)
  • IgE grass sensitization: A genome-wide meta-analysis of genetic variants associated with allergic rhinitis and grass sensitization and their interaction with birth order. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link